Patent Response

Response Fields

Field Type Description Example
lens_id String Unique lens identifier. Every document in the Lens has a unique 15-digit identifier called a Lens ID. 186-488-232-022-055
jurisdiction String The jurisidiction of the patent document. US
doc_number String The document number assigned to a patent application on publication. 20130227762
kind String The patent document kind code (varies by jurisdiction). A1
date_published Date Date of publication for the patent document. 2009-05-22
doc_key String The unique document key for the patent document. EP_0227762_B1_19900411
docdb_id Long The DOCDB identifier for the patent document. 499168393
publication_type String (Document Types) Type of patent document.  
lang String (Language) The original language of the patent document. EN
biblio Bibliographic Data    
families Families    
abstract List of Abstract The patent document abstract text.  
claims List of Claims The Claims recorded in the patent document.  
description Description The description text of the patent document.  
legal_status Legal Status Information The legal Status Information for the patent document.  
sequence_listing Sequence Listing Information on the sequences listed on the patent document.  

Bibliographic Data

Field Type Description
publication_reference Document Id The publication reference document Id.
application_reference Document Id The application reference document Id.
application_number String The application number e.g. 10/716,854
priority_claims Priority Claims The priotrity claims documents.
invention_title List of Title Title of the patent / invention.
parties Parties The parties associated with the patent (applicants, inventors, owners, agents, etc.)
classifications_cpc CPC Classifications CPC Classifications
classifications_ipcr IPCR Classifications IPCR Classifications
classifications_national US Classifications US Classifications
references_cited References Cited The references cited in the patent document (patents and non-patent literature (NPL) ).
cited_by Cited By The patents citing the patent document.

Families

Field Type Description
simple_family Simple Family Simple patent family (based on DOCDB simple patent family).
extended_family Extended Family Extended patent family (based on INPADOC extended patent family).

Simple Family

Field Type Description Example
members List of Simple Family Members List of simple family members.  
size Integer The number of simple family member documents. 12

Simple Family Members

Field Type Description Example
document_id Document Id Simple family member document Id.  
lens_id String (LensId) Simple family member Lens Id. 186-488-232-022-055

Extended Family

Field Type Description Example
members List of Extended Family Members List of extended family members.  
size Integer The number of extended family member documents. 18

Extended Family Members

Field Type Description Example
document_id Document Id Extended family member document Id.  
lens_id String (LensId) Extended family member Lens Id. 186-488-232-022-055

Abstract

Field Type Description Example
text String The patent document abstract text. A processor implements conditional vector operations in which an input vector containing multiple operands to be used in conditional operations is divided into two or more output…
lang String (Language) The language of the patent document abstract text. EN

Claims

Field Type Description Example
claims List of Claims Text The list of Claims recorded in the patent document.  
lang String (Language) The language of the patent document claims. EN

Claims Text

Field Type Description Example
claim_text List of String The Claim text recorded in the patent document. What is claimed is: 1. A method of performing a conditional vector output operation in a processor, the method comprising: receiving electrical signals representative of an input data vector…

Description

Field Type Description Example
text String The description text of the patent document. This invention was made in conjuction with U.S. Government support under U.S. Army Grant No. DABT63-96-C-0037.” BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention is directed to…
lang String (Language) The language of the patent document description. EN
Field Type Description Example
granted Boolean Indicates if the patent application has been granted in one or more jurisdictions. TRUE
grant_date Date The date the patent application was granted (i.e. the application first grant date). 2009-05-22
application_expiry_date Date The expiry date of the patent application because of withdrawal or abandonment. 2009-05-22
anticipated_term_date Date The anticipated termination date for granted patents. The anticipated termination date is calculated based on the natural term date plus any extensions. 2009-05-22
discontinuation_date Date The discontinuation date of the patent due to “unnatural death” (i.e. lapse, withdrawn, abandoned). N.B. The patent can be revived within a certain time frame. 2009-05-22
has_disclaimer Boolean Indicates if this US patent subjected to a terminal disclaimer. TRUE
patent_status String (Patent Status) The calculated legal status of the patent application. ACTIVE
has_spc Boolean Indicates if the patent has a supplementary protection certificate. TRUE
calculation_log List of String The legal status calculation log. [Application Filing Date: 2001-11-21, Earliest Filing Date: 2001-11-21 priority to EP01984746A, Granted date: 2009-07-29]

N.B. Legal status information is derived from INPADOC and USPTO Assignments data and may not be accurate. For more details, please see Patent Legal Status Calculations

Sequence Listing

Field Type Description Example
sequence_types List of String The type of sequences listed on the patent document. e.g. N - nucleotide (including DNA and RNA sub-types), P - peptides/proteins. N, RNA, DNA, P
length_buckets String Preset sequence length ranges (nucleotide: “0-100”, “101-5000”, “5001-100k”, “>100k”; Peptide: “0-50”, “51-300”, “>300”). NT_1_100, NT_101_5000, NT_5001_100000, NT_100001, AA_1_50, AA_51_300, AA_301
organisms List of Organisms List of declared organisms associated with the sequences listed on the patent document.  
count Integer The number of sequences listed on the patent document. 31

Organisms

Field Type Description Example
tax_id Integer The NCBI taxonomic identifier of the declared organism. 9606, 12110
name String The name of the declared organism. Homo sapiens, Foot-and-mouth disease virus

Priority Claims

Field Type Description
claims List of Priority Claims Documents List of priority claims documents
earliest_claim Earliest Priority Claim Earliest priority claim

Priority Claims Documents

Field Type Description Example
jurisdiction String (Jurisdiction) The jurisdiction of the priority document. DE
doc_number String The document number of the priority document. 1117265
kind String The kind code of the priority document. A1
date LocalDate The publication date of the priority document. 2009-05-22
linkage_type String (Linkage Type) The priority document linkage type. DIVISION
sequence Integer The sequence of the Prioroty Claim Document 3

Earliest Priority Claim

Field Type Description Example
date Date Earliest priority date. The earliest date of filing of a patent application, anywhere in the world, to protect an invention. The priority date may be earlier than the actual filing date of an application if an application claims priority to an earlier parent application, then its earliest priority date may be the same as the parent. 2009-05-22

Title

Field Type Description Example
text String Title of the patent / invention. Fidget Spinner
lang String (Language) The language of the patent / invention title. EN

Parties

Field Type Description
inventors List of Inventors List of inventors associated with the patent.
applicants List of Applicants List of applicants associated with the patent.
owners_all List of Owners List of owners associated with the patent.
agents List of Agents and Attorneys List of agents and attorneys associated with the patent.
examiners List of Examiners List of examiners

Inventors

Field Type Description Example
residence String The country of residence of the inventor (ISO 2-digit country code). DE
sequence Integer The sequence of the inventor listed on the patent document. 3
orcid String The inventor’s ORCID identifier. 0000-0002-7168-5006
extracted_name Name The patent inventor’s name. Engebretson Steven P
extracted_address String The address of the inventor. TORONTO, ONTARIA, CA

Applicants

Field Type Description Example
residence String The country of the applicant (ISO 2-digit country code). CA
sequence Integer The sequence of the applicant listed on the patent document. 2
extracted_name Name The patent applicant’s name. IBM
extracted_address String The applicant address as recorded on the patent. SEATTLE, WASHINGTON, US

Owners

Field Type Description Example
recorded_date Date The ownership / assignment event record date. 2009-05-22
execution_date Date The date of execution of ownership / assignment. 2009-05-22
extracted_name Name The patent owner name. CPS Technology Holdings LLC
extracted_address String The owner address as recorded on the patent or legal event. TORONTO, ONTARIA, CA
extracted_country String The owner’s country code (ISO 2-digit country code). US

Agents and Attorneys

Field Type Description Example
sequence Integer The sequence of the agent/attorney as listed on the patent document. 1
extracted_name Name The agent/attorney name. Chapman, Paul William et al.
extracted_address String The agent/attorney address as recorded on the patent. 20 Red Lion Street, GB-London WC1R 4PJ(GB)
extracted_country String The country of the agent/attorney (ISO 2-digit country code). GB

Examiners

Field Type Description Example
primary_examiner.extracted_name Name The Primary examiner’s name. Terapane; John F.
primary_examiner.department String Primary Examiner’s department. 2844
assistant_examiner.extracted_name Name The Assistant examiner’s name. Wolffe; Susan

Name

Field Type Description Example
value String The party name. Chapman, Paul William et al., CPS Technology Holdings LLC, Chapman, Paul William et al.

CPC Classifications

Field Type Description Example
classifications List of Classification Symbols List of CPC classification symbols and their attributes. H01R11/01

IPCR Classifications

Field Type Description Example
classifications List of Classification Symbols List of IPCR classification symbols and their attributes. H01R13/115

US Classifications

Field Type Description Example
classifications List of Classification Symbols List of US classification symbols and their attributes. 439/535

Classification Symbols

Field Type Description Example
symbol String Classification code symbol. H01R11/01, H01R13/115, 439/535
classification_value String Classification value. Applies to CPC and IPRC Classifications only. See Classification Value enums. I, L
classification_symbol_position String Classification symbol position. Applies to CPC and IPRC Classifications only. See Classification Symbol Position enums. F, A

References Cited

Field Type Description Example
citations List of Citations List of patent and NPL references cited.  
npl_resolved_count Integer The number of resolved scholalry works cited by a patent. 12
npl_count Integer The number of scholalry works cited by a patent. 2
patent_count Integer The number of patents cited by a patent. 2

Note: Citations can be duplicated because they appear in different phases of the patenting process.

Citations

Field Type Description Example
patcit Patents Cited Patents cited in the patent documnet.  
nplcit NPL Cited Non-patent literature cited in the patent document.  
sequence Integer The sequence of the citation in the patent document. 5
category Array Cited patent document are identified by letter(s) indicating the category of the cited document, see Citation Category enums. X
cited_phase String The phase of the patenting process when the citation was added, see Cited Phase enums. SEA

Patents Cited

Field Type Description Example
document_id Array of Document Id The cited patent document Ids.  
lens_id String (LensId) The cited patent document Lens Id. 118-962-823-688-691

NPL Cited

Field Type Description Example
text String The original non-patent literature citation text in the patent document. Cormen et al., 'Introduction to Algorithms (MIT Electrical Engineering and Computer Science Series,' MIT Press, ISBN 0262031418, pp. 665-667, 695-697.
lens_id String (LensId) The Lens Id of the resolved non-patent literature citations (i.e. scholarly work Lens Id). 168-663-423-050-326
external_ids List of String List of external identifiers for non-patent literature citation (DOI, PubMed ID, PubMed Central ID or Microsoft Aacademic ID). [10.1038/nature03090; 12345678919]

Cited By

Field Type Description
patents List of Cited By Patents List of patents citing the patent documnet.

Cited By Patents

Field Type Description Example
document_id Document Id The citing patent document Id.  
lens_id String (LensId) The citing patent Lens Id. 118-962-823-688-691

Document Id

Field Type Description Example
jurisdiction String (Jurisdiction) The jurisidiction of the patent document. US
doc_number String The document number assigned to a patent application on publication. 20130227762
kind String The patent document kind code (varies by jurisdiction). A1
date LocalDate Date of publication for the patent document, or filing date for the application reference. N.B. date information for Cited By Patents is not always available. 2009-05-22

Enums

Document Types

ABSTRACT, AMBIGUOUS, AMENDED_APPLICATION, AMENDED_PATENT, DESIGN_RIGHT, GRANTED_PATENT, LIMITED_PATENT, PATENT_APPLICATION, PATENT_OF_ADDITION, PLANT_PATENT, SEARCH_REPORT, SPC, STATUTORY_INVENTION_REGISTRATION, UNKNOWN

Jurisidction

Jurisidction codes: US, EP, WO, DE, CN, JP, GB, etc.

Language

Language codes: EN, FR, DE, CN etc.

Patent Status
  • ACTIVE - Granted patent is in force
  • PENDING - Application is pending
  • DISCONTINUED - Application discontinued, withdrawn or rejected, i.e. discontinuation before grant
  • INACTIVE - Granted patent not in force because of lapse, non-fee payment, etc. The patent hasn’t reached the term date and can be revived
  • EXPIRED - Patent has reached the term date and is no longer in force
  • PATENTED - PCT applications that have been granted in one or more designated states, or non-PCT granted patents without enough information to calculate the term date
  • UNKNOWN - Not enough information to calculate status
Cited Phase
  • SEA - Originates from the Search report, date search report completed
  • ISR - Originates from International Search Report, date international search report completed
  • SUP - Originates from Supplementary Search Report, date supplementary search report completed
  • PRS - Origin Pre-Grant/Pre-Search national, date search report completed
  • APP - Cited by the Applicant, date information available in EPO systems
  • EXA - Revealed during the Examination phase (citing document is kind-code ‘A’), date information available in EPO systems
  • OPP - Revealed during the Opposition phase, date opposition letters filed
  • APL - Filed for appeal by applicant / proprietor / patentee, date appeal filed
  • FOP - Filed for opposition by any third party, date observation letters filed
  • TPO - Third party observation, date observation letters filed
  • CH2 - Chapter 2, date international search report completed
Citation Category
  • X: Particularly relevant if taken alone.
  • I: Particularly relevant if taken alone - prejudicing inventive step.
  • Y: Particularly relevant if combined with another document of the same category.
  • A: Defining the state of the art and not prejudicing novelty or inventive step.
  • O: Non-written disclosure.
  • P: Intermediate document.
  • T: Theory or principle underlying the invention.
  • E: Earlier patent application, but published after the filing date of the application searched (potentially conflicting patent documents).
  • D: Document cited in the application.
  • L: Document cited for other reasons.
  • R: Referring to a patent application or a utility model filed on the same day that relates to the same invention
Classification Value
  • I - Invention
  • L - Later
Classification Symbol Position
  • F - First
  • A - Additional
Priority Linkage Type
  • DEFAULT - Default value
  • PCT_REGIONAL_FILING - PCT application claimed as a regional filing
  • DIVISION - Prior application claimed for a division
  • CONTINUATION - Prior application claimed for continuation
  • TECHNICAL_PRIORITY - Technical priority
  • PCT_PARIS_CONVENTION - PCT application claimed under the Paris Convention
  • CONTINUATION_IN_PART - Prior application claimed for continuation in part
  • ABANDONED_CONTINUATION - Claimed for continuation [abandoned]
  • ABANDONED_CIP - Claimed for continuation in part [abandoned]
  • DOMESTIC_PRIORITY_PATENT - Domestic priority claimed for patent
  • ABANDONED_DIVISION - Claimed for a division [abandoned]
  • ADDITION - Prior application claimed for an addition
  • DOMESTIC_PRIORITY_UTILITY - Domestic priority claimed for utility model
  • PATENT_FOR_UTILITY_MODEL - Patent application claimed for utility model
  • ORIGINAL_REISSUE - Claimed application is an original reissue serial number
  • PATENT_TO_UTILITY - Cited application changed from patent to utility
  • DOMESTIC_PRIORITY - Domestic priority
  • UNKNOWN - Unknown linkage type
  • UTILITY_TO_PATENT - Cited application changed from utility to patent
  • COGNATE - Cognate application
  • EP_REGIONAL_FILING - EP application claimed as a regional filing
  • DIVISION_OF_DIVISION - Prior application claimed for a division of a division
  • DIVISION_2 - Prior application claimed for 2 division
  • SUPPLEMENTARY_DISCLOSURE - Claimed application is a supplementary disclosure
  • WIDERRECHTLICHE_ENTNAHME - Widerrechtliche Entnahme claimed Application
  • RE_EXAMINATION - Request for re-examination number
  • SUBSTITUTE - Prior application claimed for a substitute

Sample Patent Record

Request:

{
  "query":{
  	"match":{"lens_id":"031-156-664-516-153"}
  }
}

Response:

{
    "total": 1,
    "max_score": 16.891047,
    "data": [
        {
            "lens_id": "031-156-664-516-153",
            "jurisdiction": "EP",
            "doc_number": "2471949",
            "kind": "A1",
            "date_published": "2012-07-04",
            "doc_key": "EP_2471949_A1_20120704",
            "docdb_id": 364714255,
            "lang": "en",
            "biblio": {
                "publication_reference": {
                    "jurisdiction": "EP",
                    "doc_number": "2471949",
                    "kind": "A1",
                    "date": "2012-07-04"
                },
                "application_reference": {
                    "jurisdiction": "EP",
                    "doc_number": "10197481",
                    "kind": "A",
                    "date": "2010-12-31"
                },
                "application_number": "10197481.4",
                "priority_claims": {
                    "claims": [
                        {
                            "jurisdiction": "EP",
                            "doc_number": "10197481",
                            "kind": "A",
                            "date": "2010-12-31",
                            "sequence": 1
                        }
                    ],
                    "earliest_claim": {
                        "date": "2010-12-31"
                    }
                },
                "invention_title": [
                    {
                        "text": "Verfahren zur Identifizierung durch Molekulartechniken von genetischen Varianten, die kein D-Antigen (D-) und das veränderte C-Antigen (C+W) codieren",
                        "lang": "de"
                    },
                    {
                        "text": "Method for the identification by molecular techniques of genetic variants that encode no D antigen (D-) and altered C antigen (C+W)",
                        "lang": "en"
                    },
                    {
                        "text": "Procédé pour l'identification par des techniques moléculaires de variantes génétiques ne codant pas d'antigène D (D-) et qui codent l'antigène C modifié (C+W)",
                        "lang": "fr"
                    }
                ],
                "parties": {
                    "applicants": [
                        {
                            "residence": "ES",
                            "extracted_name": {
                                "value": "PROGENIKA BIOPHARMA SA"
                            }
                        }
                    ],
                    "inventors": [
                        {
                            "residence": "ES",
                            "sequence": 1,
                            "extracted_name": {
                                "value": "OCHOA JORGE"
                            }
                        },
                        {
                            "residence": "ES",
                            "sequence": 2,
                            "extracted_name": {
                                "value": "LOPEZ MONICA"
                            }
                        },
                        {
                            "residence": "ES",
                            "sequence": 3,
                            "extracted_name": {
                                "value": "TEJEDOR DIEGO"
                            }
                        },
                        {
                            "residence": "ES",
                            "sequence": 4,
                            "extracted_name": {
                                "value": "MARTINEZ ANTONIO"
                            }
                        },
                        {
                            "residence": "ES",
                            "sequence": 5,
                            "extracted_name": {
                                "value": "SIMON LAUREANO"
                            }
                        }
                    ],
                    "agents": [
                        {
                            "extracted_name": {
                                "value": "Casley, Christopher Stuart"
                            },
                            "extracted_address": "Mewburn Ellis LLP \n33 Gutter Lane, London\nEC2V 8AS",
                            "extracted_country": "GB"
                        }
                    ],
                    "owners_all": [
                        {
                            "recorded_date": "2013-12-11",
                            "execution_date": "2013-12-11",
                            "extracted_name": {
                                "value": "PROGENIKA BIOPHARMA, S.A."
                            }
                        }
                    ]
                },
                "classifications_ipcr": {
                    "classifications": [
                        {
                            "symbol": "C12Q1/68",
                            "classification_value": "I",
                            "classification_symbol_position": "F"
                        }
                    ]
                },
                "classifications_cpc": {
                    "classifications": [
                        {
                            "symbol": "C12Q1/6881",
                            "classification_value": "I",
                            "classification_symbol_position": "F"
                        },
                        {
                            "symbol": "C12Q2600/156",
                            "classification_value": "A",
                            "classification_symbol_position": "L"
                        },
                        {
                            "symbol": "C12Q1/6881",
                            "classification_value": "I",
                            "classification_symbol_position": "F"
                        },
                        {
                            "symbol": "A61K35/14",
                            "classification_value": "I",
                            "classification_symbol_position": "L"
                        },
                        {
                            "symbol": "C12Q2600/156",
                            "classification_value": "A",
                            "classification_symbol_position": "L"
                        }
                    ]
                },
                "references_cited": {
                    "citations": [
                        {
                            "sequence": 1,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2006075254",
                                    "kind": "A2",
                                    "date": "2006-07-20"
                                },
                                "lens_id": "185-701-234-511-622"
                            },
                            "category": [
                                "X"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 2,
                            "nplcit": {
                                "text": "AVENT N D ET AL: \"The bloodgen project of the European Union, 2003-2009\", TRANSFUSION MEDICINE AND HEMOTHERAPY 2009 S. KARGER AG CHE LNKD- DOI:10.1159/000218192, vol. 36, no. 3, June 2009 (2009-06-01), pages 162 - 167, XP002633276, ISSN: 1660-3796",
                                "lens_id": "004-047-148-411-345",
                                "external_ids": [
                                    "pmc2980524",
                                    "21113258",
                                    "10.1159/000218192"
                                ]
                            },
                            "category": [
                                "I"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 3,
                            "nplcit": {
                                "text": "WESTHOFF CONNIE M ET AL: \"DIIIa and DIII Type 5 are encoded by the same allele and are associated with altered RHCE*ce alleles: clinical implications\", TRANSFUSION (MALDEN), vol. 50, no. 6, June 2010 (2010-06-01), pages 1303 - 1311, XP002633277, ISSN: 0041-1132",
                                "lens_id": "125-529-168-227-632",
                                "external_ids": [
                                    "20088832",
                                    "pmc2908519",
                                    "10.1111/j.1537-2995.2009.02573.x"
                                ]
                            },
                            "category": [
                                "X",
                                "D",
                                "I"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 4,
                            "nplcit": {
                                "text": "PHAM BACH-NGA ET AL: \"Heterogeneous molecular background of the weak C, VS+, hr(B)-, Hr(B)- phenotype in black persons\", TRANSFUSION (MALDEN), vol. 49, no. 3, March 2009 (2009-03-01), pages 495 - 504, XP002633278, ISSN: 0041-1132",
                                "lens_id": "086-240-354-498-516",
                                "external_ids": [
                                    "10.1111/j.1537-2995.2008.02005.x",
                                    "19040491"
                                ]
                            },
                            "category": [
                                "X",
                                "D",
                                "I"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 5,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2006032897",
                                    "kind": "A2",
                                    "date": "2006-03-30"
                                },
                                "lens_id": "071-147-450-571-460"
                            },
                            "category": [
                                "Y"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 6,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "DE",
                                    "doc_number": "10049363",
                                    "kind": "A1",
                                    "date": "2001-10-31"
                                },
                                "lens_id": "033-566-032-105-609"
                            },
                            "category": [
                                "Y"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 7,
                            "nplcit": {
                                "text": "FAAS B H W ET AL: \"Rh E/e genotyping by allele-specific primer amplification\", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 85, no. 3, 1 January 1995 (1995-01-01), pages 829 - 832, XP002614101, ISSN: 0006-4971",
                                "lens_id": "017-174-583-162-658",
                                "external_ids": [
                                    "7833484",
                                    "10.1182/blood.v85.3.829.bloodjournal853829"
                                ]
                            },
                            "category": [
                                "Y"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 8,
                            "nplcit": {
                                "text": "MAASKANT-VAN WIJK P A ET AL: \"GENOTYPING OR RHD BY MULTIPLEX POLYMERASE CHAIN REACTIONS ANALYSIS OF SIX RHD-SPECIFIC EXONS\", TRANSFUSION, AMERICAN ASSOCIATION OF BLOOD BANKS, BETHESDA, MD, US, vol. 11, no. 38, 1 November 1998 (1998-11-01), pages 1015 - 1021, XP008005129, ISSN: 0041-1132, DOI: 10.1046/J.1537-2995.1998.38111299056309.X",
                                "lens_id": "059-652-196-800-856",
                                "external_ids": [
                                    "10.1046/j.1537-2995.1998.38111299056309.x",
                                    "9838930"
                                ]
                            },
                            "category": [
                                "Y"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 9,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2011003921",
                                    "kind": "A2",
                                    "date": "2011-01-13"
                                },
                                "lens_id": "187-498-666-224-100"
                            },
                            "category": [
                                "E"
                            ],
                            "cited_phase": "SEA"
                        },
                        {
                            "sequence": 1,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2009000084",
                                    "kind": "A1",
                                    "date": "2008-12-31"
                                },
                                "lens_id": "096-184-763-479-702"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 2,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010000210",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "082-610-612-867-442"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 3,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010000380",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "080-193-167-878-372"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 4,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010000635",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "160-241-370-254-307"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 5,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010000972",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "189-848-800-128-321"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 6,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010002366",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "091-724-438-661-108"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 7,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010002367",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "180-004-304-457-874"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 8,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010003113",
                                    "kind": "A1",
                                    "date": "2010-01-07"
                                },
                                "lens_id": "014-308-334-256-321"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 9,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010003649",
                                    "kind": "A1",
                                    "date": "2010-01-14"
                                },
                                "lens_id": "149-519-969-815-807"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 10,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010003664",
                                    "kind": "A1",
                                    "date": "2010-01-14"
                                },
                                "lens_id": "134-590-889-498-511"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 11,
                            "patcit": {
                                "document_id": {
                                    "jurisdiction": "WO",
                                    "doc_number": "2010003809",
                                    "kind": "A2",
                                    "date": "2010-01-14"
                                },
                                "lens_id": "087-699-367-879-444"
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 12,
                            "nplcit": {
                                "text": "M. E. REID; C. LOMAS-FRANCIS: \"The Blood Group Antigen FactsBook\", 2004, ELSEVIER LTD."
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 13,
                            "nplcit": {
                                "text": "CONNIE M.; WESTHOFF, SUNITHA VEGE; CHRISTINE HALTER-HIPSKY; TRINA WHORLEY; KIM HUE-ROYE; CHRISTINE LOMAS-FRANCIS; MARION E.: \"Dllla and Dill Type 5 are encoded by the same allele and are associated with altered RHCE*ce alleles: clinical implications\", REID. TRANSFUSION, vol. 50, 2010, pages 1303 - 1311",
                                "lens_id": "125-529-168-227-632",
                                "external_ids": [
                                    "20088832",
                                    "pmc2908519",
                                    "10.1111/j.1537-2995.2009.02573.x"
                                ]
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 14,
                            "nplcit": {
                                "text": "BACH-NGA PHAM; THIERRY PEYRARD; GENEVIEVE JUSZCZAK; ISABELLE DUBEAUX; DOMINIQUE GIEN; ANTOINE BLANCHER; JEAN-PIERRE CARTRON; PHILI: \"Heterogeneous molecular background of the weak C, VS+, hrB-, HrB- phenotype in black persons\", TRANSFUSION, vol. 49, 2009, pages 495 - 504",
                                "lens_id": "086-240-354-498-516",
                                "external_ids": [
                                    "10.1111/j.1537-2995.2008.02005.x",
                                    "19040491"
                                ]
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 15,
                            "nplcit": {
                                "text": "MARTINE G.H.M.; TAX, C.; ELLEN VAN DER SCHOOT; RENE' VAN DOORN; LOTTE DOUGLAS-BERGER; DICK J.; VAN RHENEN; PETRA A.; MAASKANT-VAN: \"RHC and RHc genotyping in different ethnic groups\", TRANSFUSION, vol. 42, 2002, pages 6234 - 644",
                                "lens_id": "028-957-496-647-171",
                                "external_ids": [
                                    "12084173",
                                    "10.1046/j.1537-2995.2002.00096.x"
                                ]
                            },
                            "cited_phase": "APP"
                        },
                        {
                            "sequence": 16,
                            "nplcit": {
                                "text": "M. E. REID; C. LOMAS-FRANCIS.: \"The Blood group antigen FactsBook\", 2004, ELSEVIER LTD."
                            },
                            "cited_phase": "APP"
                        }
                    ],
                    "patent_count": 15,
                    "npl_count": 10,
                    "npl_resolved_count": 8
                },
                "cited_by": {
                    "patents": [
                        {
                            "document_id": {
                                "jurisdiction": "WO",
                                "doc_number": "2014135331",
                                "kind": "A1"
                            },
                            "lens_id": "089-849-576-069-505"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "WO",
                                "doc_number": "2012171990",
                                "kind": "A1"
                            },
                            "lens_id": "084-623-881-707-629"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "9359643",
                                "kind": "B2"
                            },
                            "lens_id": "007-584-344-944-889"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "10253366",
                                "kind": "B2"
                            },
                            "lens_id": "172-445-088-115-557"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "9637788",
                                "kind": "B2"
                            },
                            "lens_id": "138-800-291-931-331"
                        }
                    ],
                    "patent_count": 5
                }
            },
            "families": {
                "simple_family": {
                    "family_id": 212482337,
                    "members": [
                        {
                            "document_id": {
                                "jurisdiction": "EP",
                                "doc_number": "2471949",
                                "kind": "B1",
                                "date": "2013-12-25"
                            },
                            "lens_id": "033-643-087-926-128"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "EP",
                                "doc_number": "2471949",
                                "kind": "A1",
                                "date": "2012-07-04"
                            },
                            "lens_id": "031-156-664-516-153"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "20120172239",
                                "kind": "A1",
                                "date": "2012-07-05"
                            },
                            "lens_id": "095-621-040-202-546"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "ES",
                                "doc_number": "2445709",
                                "kind": "T3",
                                "date": "2014-03-04"
                            },
                            "lens_id": "192-287-095-019-170"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "20160060696",
                                "kind": "A1",
                                "date": "2016-03-03"
                            },
                            "lens_id": "126-336-041-308-107"
                        }
                    ],
                    "size": 5
                },
                "extended_family": {
                    "family_id": 212231137,
                    "members": [
                        {
                            "document_id": {
                                "jurisdiction": "EP",
                                "doc_number": "2471949",
                                "kind": "B1",
                                "date": "2013-12-25"
                            },
                            "lens_id": "033-643-087-926-128"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "EP",
                                "doc_number": "2471949",
                                "kind": "A1",
                                "date": "2012-07-04"
                            },
                            "lens_id": "031-156-664-516-153"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "ES",
                                "doc_number": "2445709",
                                "kind": "T3",
                                "date": "2014-03-04"
                            },
                            "lens_id": "192-287-095-019-170"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "20120172239",
                                "kind": "A1",
                                "date": "2012-07-05"
                            },
                            "lens_id": "095-621-040-202-546"
                        },
                        {
                            "document_id": {
                                "jurisdiction": "US",
                                "doc_number": "20160060696",
                                "kind": "A1",
                                "date": "2016-03-03"
                            },
                            "lens_id": "126-336-041-308-107"
                        }
                    ],
                    "size": 5
                }
            },
            "sequence_listing": {
                "sequence_types": [
                    "N",
                    "DNA"
                ],
                "length_buckets": [
                    "NT_1_100",
                    "NT_5001_100000",
                    "NT_101_5000"
                ],
                "organisms": [
                    {
                        "tax_id": 9606,
                        "name": "Homo sapiens"
                    },
                    {
                        "tax_id": -1,
                        "name": "Unknown/Artificial"
                    }
                ],
                "count": 42
            },
            "legal_status": {
                "granted": true,
                "grant_date": "2013-12-25",
                "anticipated_term_date": "2030-12-31",
                "calculation_log": [
                    "Application Filing Date: 2010-12-31",
                    "Granted Date: 2013-12-25",
                    "Anticipated Termination Date: 2030-12-31"
                ],
                "patent_status": "ACTIVE"
            },
            "abstract": [
                {
                    "text": "The invention relates to the field of genotyping and blood cell antigen determination. In particular, the invention adresses the problem of discriminating the RHD*DIIIa-CE(4-7)-D or RHD*DIIIa-CE(4-7)-D )-like blood type variants, which express the C +w antigen and lack a D antigen, from RHD*DIIIa , RHD*DIVa-2 and other blood type variants. The invention provides methods for genotyping a subject, comprising: a) determining at least 4 markers in a sample that has been obtained from the subject, wherein the markers comprise: (i) the presence or absence of an RHCE*C allele; (ii) the presence or absence of an RHD/RHCE hybrid exon 3 (RHD/CE Hex03) allele; (iii) the absence of, or a single nucleotide polymorphism (SNP) variant within, of any one of the SNPs at position 602 of RHD exon 4, position 667 of RHD exon 5, or position 819 of RHD exon 6; and (iv) the absence of, or SNP variant within, of the SNP at position 1048 of RHD exon 7. The invention also provides products, in particular, probes, primers and kits for use in such methods.",
                    "lang": "en"
                }
            ],
            "claims": [
                {
                    "claims": [
                        {
                            "claim_text": [
                                "A method of genotyping a subject, the method comprising:\n determining at least 4 markers in a sample that has been obtained from the subject, wherein the markers comprise:\n (i) the presence or absence of an RHCE*C allele; \n (ii) the presence or absence of an RHD/RHCE hybrid exon 3 (RHD/CE Hex03) allele; \n (iii) the absence of, or a single nucleotide polymorphism (SNP) variant within, any one of RHD exon 4,  RHD  exon 5, or  RHD  exon 6; and \n (iv) the absence of, or SNP variant within, RHD exon 7."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to claim 1, wherein:\n a) the SNP variant within  RHD  exon 4 is at position 602 of the  RHD  coding sequence (rs1053355), the SNP variant within  RHD  exon 5 is at position 667 of the  RHD  coding sequence (rs1053356), the SNP variant within  RHD  exon 6 is at position 819 of the  RHD  coding sequence; and/or \n b) the SNP variant within  RHD  exon 7 is at position 1048 of the  RHD  coding sequence (rs41307826)."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to claim 1 or 2, wherein the markers further comprise:\n (v) the presence or absence of an RHD exon 3 allele."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to any one of the preceding claims, wherein:\n a) the method further comprises determining the RHD and RHC antigen phenotypes of the subject; and/or \n b) the method comprises detecting the presence or absence of a blood type variant selected from:  RHD*DIIIa ;  RHD*DIVa-2;  or  RHD*DIIIa-CE(4-7)-D  or  RHD*DIIIa-CE(4-7)-D )-like blood type variants, e.g. wherein the method comprises detecting the presence or absence of  RHD*DIIIa-CE(4-7)-D  or  RHD*DIIIa-CE(4-7)-D )-like blood type variants; and/or \n c) marker (iii) is the SNP within RHD exon 4 at position 602 of the RHD coding sequence (rs1053355); and/or \n d) the RHCE*C allele is determined by determining the presence or absence of RHCE*C intron 2, or any one of the following positions in the RHCE coding sequence: position 307 (exon 2), position 48 (exon 1), position 150 (exon 2), position 178 (exon 2), position 201 (exon 2) and/or position 203 (exon 2)."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to any one of the preceding claims, wherein the sample comprises nucleic acid and the method comprises amplifying the nucleic acid or a portion thereof by PCR using primers, e.g. wherein:\n a) the PCR primers for determining the RHCE*C allele are a forward PCR primer specific for RHCE*C, and a non-specific reverse PCR primer, e.g. wherein\n (i) the non-specific reverse primer is shared with RHD, RHC*C and/or RHC*c; and/or \n (ii) the PCR primers comprise:\n Forward: 5'-GGCCACCACCATTTGAA-3' (SEQ ID NO: 3) \n Reverse: 5'-CCATGAACATGCCACTTCAC-3', (SEQ ID NO: 4) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n b) the PCR primers for determining the RHD/CE Hex03 allele are forward and reverse PCR primers targeting sequences located in introns 2 and 3, or introns 3 and 2, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TCCTGGCTCTCCCTCTCT-3' (SEQ ID NO: 9) \n Reverse primer: 5'-TTTTCAAAACCCCGGAAG-3 (SEQ ID NO: 10) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n c) the PCR primers for determining the SNP within RHD exon 4 at position 602 of the RHD coding sequence (rs1053355) are forward and reverse primers targeting sequences located in introns 3 and 4, or introns 4 and 3, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-GCTCTGAACTTTCTCCAAGGACT-3' (SEQ ID NO: 17) \n Reverse primer: 5'-ATTCTGCTCAGCCCAAGTAG-3' (SEQ ID NO: 18) or a variant thereof having up to 4 nucleotide alterations; and/or \n d) the PCR primers for determining the SNP within RHD exon 5 at position 667 of the  RHD  coding sequence (rs1053356) are forward and reverse primers targeting sequences located in introns 4 and 5, or introns 5 and 4, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TTGAATTAAGCACTTCACAGAGCA-3' (SEQ ID NO: 19) \n Reverse primer: 5'-CACCTTGCTGATCTTCCC-3' (SEQ ID NO: 20) or a variant thereof having up to 4 nucleotide alterations; and/or \n e) the PCR primers for determining the SNP within RHD exon 6 at position 819 of the  RHD  coding sequence are forward and reverse primers targeting sequences located in introns 5 and 6, or introns 6 and 5, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-AGTAGTGAGCTGGCCCATCA-3' (SEQ ID NO: 21) \n Reverse primer: 5'-CTTCAGCCAAAGCAGAGGAG-3' (SEQ ID NO: 22) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n f) the PCR primers for determining the SNP within RHD exon 7 at position 1048 of the  RHD  coding sequence (rs41307826) are forward and reverse primers targeting sequences located in introns 6 and 7, or introns 7 and 6, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-ACAAACTCCCCGATGATGTGAGTG-3' (SEQ ID NO: 35) \n Reverse primer: 5'-GAGGCTGAGAAAGGTTAAGCCA-3' (SEQ ID NO: 36) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n g) as dependent from claim 3, the PCR primers for determining the RHD exon 3 allele are forward and reverse primers targeting sequences located in introns 2 and 3, or introns 3 and 2, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TCCTGGCTCTCCCTCTCT-3' (SEQ ID NO: 15) \n Reverse primer: 5'-GTTGTCTTTATTTTTCAAAACCCT-3' (SEQ ID NO: 16) \nor a variant thereof having up to 4 nucleotide alterations."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to claim 5, wherein the amplified nucleic acid comprises a label, e.g. wherein\n a) the label comprises a biotinylated nucleotide; and/or \n b) the label comprises a fluorescent moiety."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to any one of the preceding claims, wherein the sample comprises nucleic acid, and the method comprises amplifying the nucleic acid or a portion thereof by PCR using primers, fragmenting the amplified nucleic acid, and labelling the fragmented nucleic acid with biotinylated ddNTPS using a terminal deoxynucleotidyl transferase (TdT) enzyme."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to any one of the preceding claims, wherein determining the presence, absence or SNP variant of a marker comprises contacting nucleic acid containing each marker with one or more probes, e.g. wherein:\n a) as dependent from claim 3, the probes for determining the presence or absence of RHD/CE Hex03 or RHD exon 3 contact an SNP located in both RHD/CE Hex03 and RHD exon 3, wherein one SNP variant is specific for RHD/CE Hex03, and another SNP variant is specific for RHD exon 3, e.g. wherein\n (i) the SNP is at position 410 of the coding sequence, located within both RHD/CE Hex03 and RHD exon 3; and/or \n (ii) the probes comprise:\n (1) 5'-TTTTACAGACGCCTGCTACCATG-3', (SEQ ID NO: 5) \n (2) 5'-CATGGTAGCAGGCGTCTGTAAAA-3', (SEQ ID NO: 6) \n (3) 5'-TTTTACAGACGTCTGCTACCATG-3', (SEQ ID NO: 7) and \n (4) 5'-CATGGTAGCAGACGTCTGTAAAA-3', (SEQ ID NO: 8) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; and/or \n b) the probes for determining the absence or SNP variant of the SNP at: position 602 of the  RHD  coding sequence located within exon 4 (rs1053355), position 667 of the  RHD  coding sequence located within exon 5 (rs1053356), or position 819 of the  RHD  coding sequence located within exon 6 comprise:\n (i) RHD exon 4:\n (1) 5'-ATAAAGATCAGACAGCAACGATACC-3' (SEQ ID NO: 23) \n (2) 5'-TAAAGATCAGACAGCAACGATAC-3' (SEQ ID NO: 24) \n (3) 5'-ATAAAGATCAGAGAGCAACGATACC-3' (SEQ ID NO: 25) \n (4) 5'-TAAAGATCAGAGAGCAACGATAC-3' (SEQ ID NO: 26) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; \n (ii) RHD exon 5:\n (1) 5'-CTGGCCAAGTTTCAACTCTGC-3' (SEQ ID NO: 27) \n (2) 5'-TGGCCAAGTTTCAACTCTG-3' (SEQ ID NO: 28) \n (3) 5'-CTGGCCAAGTGTCAACTCTGC-3' (SEQ ID NO: 29) \n (4) 5'-TGGCCAAGTGTCAACTCTG-3' (SEQ ID NO: 30) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; \n (iii) RHD exon 6:\n (1) 5'-GTGCACAGTGCGGTGTTGGCAGG-3' (SEQ ID NO: 31) \n (2) 5'- TGCACAGTGCGGTGTTGGCAG -3' (SEQ ID NO: 32) \n (3) 5'- GTGCACAGTGCAGTGTTGGCAGG -3' (SEQ ID NO: 33) \n (4) 5'-TGCACAGTGCAGTGTTGGCAG-3' (SEQ ID NO: 34) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations. \n c) the probes for determining the SNP variant of the SNP at position 1048 of the  RHD  coding sequence located within exon 7 (rs41307826)comprise:\n (1) 5'-TGCTGGTGCTTGATACCGTCGGA-3' (SEQ ID NO: 37) \n (2) 5'-GCTGGTGCTTGATACCGTCGG-3' (SEQ ID NO: 38) \n (3) 5'-TGCTGGTGCTTCATACCGTCGGA-3' (SEQ ID NO: 39) \n (4) 5'-GCTGGTGCTTCATACCGTCGG-3' (SEQ ID NO: 40) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations."
                            ]
                        },
                        {
                            "claim_text": [
                                "A method according to claim 8, wherein\n a) one or more of the probes comprise a label, e.g. wherein the label is a fluorescent moiety; and/or \n b) one or more of the probes is attached to a solid support or conjugated to one or more particles.."
                            ]
                        },
                        {
                            "claim_text": [
                                "A set of primers for amplifying nucleic acid comprising at least four of the markers described in claim 1, 2, 3, 4(c), and 4(d), e.g. wherein the set of primers comprises at least three primer pairs selected from the primers set forth in:\n (i) claim 5(a), \n (ii) claim 5(b), \n (iii) any one of claims 5(c), 5(d) or 5(e) \n (iv) claim 5(f), and \n (v) claim 5(g)."
                            ]
                        },
                        {
                            "claim_text": [
                                "A set of primers for amplifying nucleic acid comprising at least three primer pairs selected from the primers set forth in:\n (i) claim 3(a)(ii), \n (ii) claim 3(b)(i), \n (iii) any one of claims 3(c)(i), 3(d)(i) or 3(e)(i), \n (iv) claim 3(f)(i), and \n (v) claim 3(g)(i)."
                            ]
                        },
                        {
                            "claim_text": [
                                "A set of primers for amplifying nucleic acid , wherein at least 50% are the primer pairs described in claim 10 or 11."
                            ]
                        },
                        {
                            "claim_text": [
                                "A set of probes for determining the presence, absence or single nucleotide polymorphism (SNP) variant of at least three of the markers described in claim 1, 2, 3, 2(c) and 2(d), e.g. wherein:\n a) the set of probes comprises the probes described in claims 8(a), 8(b) and 8(c)."
                            ]
                        },
                        {
                            "claim_text": [
                                "A set of probes according to claim 13, wherein:\n a) the probes are immobilised on a solid support or conjugated to one or more particles, e.g. wherein the solid support comprises one or more attached labels, e.g. wherein the label is a fluorochrome; and/or \n b) one or more probes comprise a label, e.g wherein the label is a fluorescent moiety."
                            ]
                        },
                        {
                            "claim_text": [
                                "A kit for genotyping a subject, the kit comprising a set of PCR primers according to any one of claims 10 to 12, and a set of probes according to any one of claims 13 or 14."
                            ]
                        }
                    ],
                    "lang": "en"
                }
            ],
            "description": {
                "text": "Field of the Invention The invention relates to methods for genotyping and blood cell antigen determination, which in particular may discriminate the  RHD*DIIIa-CE(4-7)-D  or  RHD*DIIIa-CE(4-7)-D )-like blood type variants, which express the C +W  antigen and lack a D antigen, from  RHD*DIIIa ,  RHD*DIVa-2  and other blood type variants...",
                "lang": "en"
            },
            "publication_type": "PATENT_APPLICATION"
        }
    ],
    "results": 1
}