Patent Response
Response Fields
| Field | Type | Description | Example |
|---|---|---|---|
| lens_id | String | Unique lens identifier. Every document in the Lens has a unique 15-digit identifier called a Lens ID. | 186-488-232-022-055 |
| jurisdiction | String | The jurisidiction of the patent document. | US |
| doc_number | String | The document number assigned to a patent application on publication. | 20130227762 |
| kind | String | The patent document kind code (varies by jurisdiction). | A1 |
| date_published | Date | Date of publication for the patent document. | 2009-05-22 |
| doc_key | String | The unique document key for the patent document. | EP_0227762_B1_19900411 |
| docdb_id | Long | The DOCDB identifier for the patent document. | 499168393 |
| publication_type | String (Document Types) | Type of patent document. | |
| lang | String (Language) | The original language of the patent document. | EN |
| biblio | Bibliographic Data | ||
| families | Families | ||
| abstract | List of Abstract | The patent document abstract text. | |
| claims | List of Claims | The Claims recorded in the patent document. | |
| description | Description | The description text of the patent document. | |
| legal_status | Legal Status Information | The legal Status Information for the patent document. | |
| sequence_listing | Sequence Listing | Information on the sequences listed on the patent document. |
Bibliographic Data
| Field | Type | Description |
|---|---|---|
| publication_reference | Document Id | The publication reference document Id. |
| application_reference | Document Id | The application reference document Id. |
| application_number | String | The application number e.g. 10/716,854 |
| priority_claims | Priority Claims | The priotrity claims documents. |
| invention_title | List of Title | Title of the patent / invention. |
| parties | Parties | The parties associated with the patent (applicants, inventors, owners, agents, etc.) |
| classifications_cpc | CPC Classifications | CPC Classifications |
| classifications_ipcr | IPCR Classifications | IPCR Classifications |
| classifications_national | US Classifications | US Classifications |
| references_cited | References Cited | The references cited in the patent document (patents and non-patent literature (NPL) ). |
| cited_by | Cited By | The patents citing the patent document. |
Families
| Field | Type | Description |
|---|---|---|
| simple_family | Simple Family | Simple patent family (based on DOCDB simple patent family). |
| extended_family | Extended Family | Extended patent family (based on INPADOC extended patent family). |
Simple Family
| Field | Type | Description | Example |
|---|---|---|---|
| members | List of Simple Family Members | List of simple family members. | |
| size | Integer | The number of simple family member documents. | 12 |
Simple Family Members
| Field | Type | Description | Example |
|---|---|---|---|
| document_id | Document Id | Simple family member document Id. | |
| lens_id | String (LensId) | Simple family member Lens Id. | 186-488-232-022-055 |
Extended Family
| Field | Type | Description | Example |
|---|---|---|---|
| members | List of Extended Family Members | List of extended family members. | |
| size | Integer | The number of extended family member documents. | 18 |
Extended Family Members
| Field | Type | Description | Example |
|---|---|---|---|
| document_id | Document Id | Extended family member document Id. | |
| lens_id | String (LensId) | Extended family member Lens Id. | 186-488-232-022-055 |
Abstract
| Field | Type | Description | Example |
|---|---|---|---|
| text | String | The patent document abstract text. | A processor implements conditional vector operations in which an input vector containing multiple operands to be used in conditional operations is divided into two or more output… |
| lang | String (Language) | The language of the patent document abstract text. | EN |
Claims
| Field | Type | Description | Example |
|---|---|---|---|
| claims | List of Claims Text | The list of Claims recorded in the patent document. | |
| lang | String (Language) | The language of the patent document claims. | EN |
Claims Text
| Field | Type | Description | Example |
|---|---|---|---|
| claim_text | List of String | The Claim text recorded in the patent document. | What is claimed is: 1. A method of performing a conditional vector output operation in a processor, the method comprising: receiving electrical signals representative of an input data vector… |
Description
| Field | Type | Description | Example |
|---|---|---|---|
| text | String | The description text of the patent document. | This invention was made in conjuction with U.S. Government support under U.S. Army Grant No. DABT63-96-C-0037.” BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention is directed to… |
| lang | String (Language) | The language of the patent document description. | EN |
Legal Status Information
| Field | Type | Description | Example |
|---|---|---|---|
| granted | Boolean | Indicates if the patent application has been granted in one or more jurisdictions. | TRUE |
| grant_date | Date | The date the patent application was granted (i.e. the application first grant date). | 2009-05-22 |
| application_expiry_date | Date | The expiry date of the patent application because of withdrawal or abandonment. | 2009-05-22 |
| anticipated_term_date | Date | The anticipated termination date for granted patents. The anticipated termination date is calculated based on the natural term date plus any extensions. | 2009-05-22 |
| discontinuation_date | Date | The discontinuation date of the patent due to “unnatural death” (i.e. lapse, withdrawn, abandoned). N.B. The patent can be revived within a certain time frame. | 2009-05-22 |
| has_disclaimer | Boolean | Indicates if this US patent subjected to a terminal disclaimer. | TRUE |
| patent_status | String (Patent Status) | The calculated legal status of the patent application. | ACTIVE |
| has_spc | Boolean | Indicates if the patent has a supplementary protection certificate. | TRUE |
| calculation_log | List of String | The legal status calculation log. | [Application Filing Date: 2001-11-21, Earliest Filing Date: 2001-11-21 priority to EP01984746A, Granted date: 2009-07-29] |
N.B. Legal status information is derived from INPADOC and USPTO Assignments data and may not be accurate. For more details, please see Patent Legal Status Calculations
Sequence Listing
| Field | Type | Description | Example |
|---|---|---|---|
| sequence_types | List of String | The type of sequences listed on the patent document. e.g. N - nucleotide (including DNA and RNA sub-types), P - peptides/proteins. | N, RNA, DNA, P |
| length_buckets | String | Preset sequence length ranges (nucleotide: “0-100”, “101-5000”, “5001-100k”, “>100k”; Peptide: “0-50”, “51-300”, “>300”). | NT_1_100, NT_101_5000, NT_5001_100000, NT_100001, AA_1_50, AA_51_300, AA_301 |
| organisms | List of Organisms | List of declared organisms associated with the sequences listed on the patent document. | |
| count | Integer | The number of sequences listed on the patent document. | 31 |
Organisms
| Field | Type | Description | Example |
|---|---|---|---|
| tax_id | Integer | The NCBI taxonomic identifier of the declared organism. | 9606, 12110 |
| name | String | The name of the declared organism. | Homo sapiens, Foot-and-mouth disease virus |
Priority Claims
| Field | Type | Description |
|---|---|---|
| claims | List of Priority Claims Documents | List of priority claims documents |
| earliest_claim | Earliest Priority Claim | Earliest priority claim |
Priority Claims Documents
| Field | Type | Description | Example |
|---|---|---|---|
| jurisdiction | String (Jurisdiction) | The jurisdiction of the priority document. | DE |
| doc_number | String | The document number of the priority document. | 1117265 |
| kind | String | The kind code of the priority document. | A1 |
| date | LocalDate | The publication date of the priority document. | 2009-05-22 |
| linkage_type | String (Linkage Type) | The priority document linkage type. | DIVISION |
| sequence | Integer | The sequence of the Prioroty Claim Document | 3 |
Earliest Priority Claim
| Field | Type | Description | Example |
|---|---|---|---|
| date | Date | Earliest priority date. The earliest date of filing of a patent application, anywhere in the world, to protect an invention. The priority date may be earlier than the actual filing date of an application if an application claims priority to an earlier parent application, then its earliest priority date may be the same as the parent. | 2009-05-22 |
Title
| Field | Type | Description | Example |
|---|---|---|---|
| text | String | Title of the patent / invention. | Fidget Spinner |
| lang | String (Language) | The language of the patent / invention title. | EN |
Parties
| Field | Type | Description |
|---|---|---|
| inventors | List of Inventors | List of inventors associated with the patent. |
| applicants | List of Applicants | List of applicants associated with the patent. |
| owners_all | List of Owners | List of owners associated with the patent. |
| agents | List of Agents and Attorneys | List of agents and attorneys associated with the patent. |
| examiners | List of Examiners | List of examiners |
Inventors
| Field | Type | Description | Example |
|---|---|---|---|
| residence | String | The country of residence of the inventor (ISO 2-digit country code). | DE |
| sequence | Integer | The sequence of the inventor listed on the patent document. | 3 |
| orcid | String | The inventor’s ORCID identifier. | 0000-0002-7168-5006 |
| extracted_name | Name | The patent inventor’s name. | Engebretson Steven P |
| extracted_address | String | The address of the inventor. | TORONTO, ONTARIA, CA |
Applicants
| Field | Type | Description | Example |
|---|---|---|---|
| residence | String | The country of the applicant (ISO 2-digit country code). | CA |
| sequence | Integer | The sequence of the applicant listed on the patent document. | 2 |
| extracted_name | Name | The patent applicant’s name. | IBM |
| extracted_address | String | The applicant address as recorded on the patent. | SEATTLE, WASHINGTON, US |
Owners
| Field | Type | Description | Example |
|---|---|---|---|
| recorded_date | Date | The ownership / assignment event record date. | 2009-05-22 |
| execution_date | Date | The date of execution of ownership / assignment. | 2009-05-22 |
| extracted_name | Name | The patent owner name. | CPS Technology Holdings LLC |
| extracted_address | String | The owner address as recorded on the patent or legal event. | TORONTO, ONTARIA, CA |
| extracted_country | String | The owner’s country code (ISO 2-digit country code). | US |
Agents and Attorneys
| Field | Type | Description | Example |
|---|---|---|---|
| sequence | Integer | The sequence of the agent/attorney as listed on the patent document. | 1 |
| extracted_name | Name | The agent/attorney name. | Chapman, Paul William et al. |
| extracted_address | String | The agent/attorney address as recorded on the patent. | 20 Red Lion Street, GB-London WC1R 4PJ(GB) |
| extracted_country | String | The country of the agent/attorney (ISO 2-digit country code). | GB |
Examiners
| Field | Type | Description | Example |
|---|---|---|---|
| primary_examiner.extracted_name | Name | The Primary examiner’s name. | Terapane; John F. |
| primary_examiner.department | String | Primary Examiner’s department. | 2844 |
| assistant_examiner.extracted_name | Name | The Assistant examiner’s name. | Wolffe; Susan |
Name
| Field | Type | Description | Example |
|---|---|---|---|
| value | String | The party name. | Chapman, Paul William et al., CPS Technology Holdings LLC, Chapman, Paul William et al. |
CPC Classifications
| Field | Type | Description | Example |
|---|---|---|---|
| classifications | List of Classification Symbols | List of CPC classification symbols and their attributes. | H01R11/01 |
IPCR Classifications
| Field | Type | Description | Example |
|---|---|---|---|
| classifications | List of Classification Symbols | List of IPCR classification symbols and their attributes. | H01R13/115 |
US Classifications
| Field | Type | Description | Example |
|---|---|---|---|
| classifications | List of Classification Symbols | List of US classification symbols and their attributes. | 439/535 |
Classification Symbols
| Field | Type | Description | Example |
|---|---|---|---|
| symbol | String | Classification code symbol. | H01R11/01, H01R13/115, 439/535 |
| classification_value | String | Classification value. Applies to CPC and IPRC Classifications only. See Classification Value enums. | I, L |
| classification_symbol_position | String | Classification symbol position. Applies to CPC and IPRC Classifications only. See Classification Symbol Position enums. | F, A |
References Cited
| Field | Type | Description | Example |
|---|---|---|---|
| citations | List of Citations | List of patent and NPL references cited. | |
| npl_resolved_count | Integer | The number of resolved scholalry works cited by a patent. | 12 |
| npl_count | Integer | The number of scholalry works cited by a patent. | 2 |
| patent_count | Integer | The number of patents cited by a patent. | 2 |
Note: Citations can be duplicated because they appear in different phases of the patenting process.
Citations
| Field | Type | Description | Example |
|---|---|---|---|
| patcit | Patents Cited | Patents cited in the patent documnet. | |
| nplcit | NPL Cited | Non-patent literature cited in the patent document. | |
| sequence | Integer | The sequence of the citation in the patent document. | 5 |
| category | Array | Cited patent document are identified by letter(s) indicating the category of the cited document, see Citation Category enums. | X |
| cited_phase | String | The phase of the patenting process when the citation was added, see Cited Phase enums. | SEA |
Patents Cited
| Field | Type | Description | Example |
|---|---|---|---|
| document_id | Array of Document Id | The cited patent document Ids. | |
| lens_id | String (LensId) | The cited patent document Lens Id. | 118-962-823-688-691 |
NPL Cited
| Field | Type | Description | Example |
|---|---|---|---|
| text | String | The original non-patent literature citation text in the patent document. | Cormen et al., 'Introduction to Algorithms (MIT Electrical Engineering and Computer Science Series,' MIT Press, ISBN 0262031418, pp. 665-667, 695-697. |
| lens_id | String (LensId) | The Lens Id of the resolved non-patent literature citations (i.e. scholarly work Lens Id). | 168-663-423-050-326 |
| external_ids | List of String | List of external identifiers for non-patent literature citation (DOI, PubMed ID, PubMed Central ID or Microsoft Aacademic ID). | [10.1038/nature03090; 12345678919] |
Cited By
| Field | Type | Description |
|---|---|---|
| patents | List of Cited By Patents | List of patents citing the patent documnet. |
Cited By Patents
| Field | Type | Description | Example |
|---|---|---|---|
| document_id | Document Id | The citing patent document Id. | |
| lens_id | String (LensId) | The citing patent Lens Id. | 118-962-823-688-691 |
Document Id
| Field | Type | Description | Example |
|---|---|---|---|
| jurisdiction | String (Jurisdiction) | The jurisidiction of the patent document. | US |
| doc_number | String | The document number assigned to a patent application on publication. | 20130227762 |
| kind | String | The patent document kind code (varies by jurisdiction). | A1 |
| date | LocalDate | Date of publication for the patent document, or filing date for the application reference. N.B. date information for Cited By Patents is not always available. | 2009-05-22 |
Enums
Document Types
ABSTRACT, AMBIGUOUS, AMENDED_APPLICATION, AMENDED_PATENT, DESIGN_RIGHT, GRANTED_PATENT, LIMITED_PATENT, PATENT_APPLICATION, PATENT_OF_ADDITION, PLANT_PATENT, SEARCH_REPORT, SPC, STATUTORY_INVENTION_REGISTRATION, UNKNOWN
Jurisidction
Jurisidction codes: US, EP, WO, DE, CN, JP, GB, etc.
Language
Language codes: EN, FR, DE, CN etc.
Patent Status
ACTIVE- Granted patent is in forcePENDING- Application is pendingDISCONTINUED- Application discontinued, withdrawn or rejected, i.e. discontinuation before grantINACTIVE- Granted patent not in force because of lapse, non-fee payment, etc. The patent hasn’t reached the term date and can be revivedEXPIRED- Patent has reached the term date and is no longer in forcePATENTED- PCT applications that have been granted in one or more designated states, or non-PCT granted patents without enough information to calculate the term dateUNKNOWN- Not enough information to calculate status
Cited Phase
SEA- Originates from the Search report, date search report completedISR- Originates from International Search Report, date international search report completedSUP- Originates from Supplementary Search Report, date supplementary search report completedPRS- Origin Pre-Grant/Pre-Search national, date search report completedAPP- Cited by the Applicant, date information available in EPO systemsEXA- Revealed during the Examination phase (citing document is kind-code ‘A’), date information available in EPO systemsOPP- Revealed during the Opposition phase, date opposition letters filedAPL- Filed for appeal by applicant / proprietor / patentee, date appeal filedFOP- Filed for opposition by any third party, date observation letters filedTPO- Third party observation, date observation letters filedCH2- Chapter 2, date international search report completed
Citation Category
X: Particularly relevant if taken alone.I: Particularly relevant if taken alone - prejudicing inventive step.Y: Particularly relevant if combined with another document of the same category.A: Defining the state of the art and not prejudicing novelty or inventive step.O: Non-written disclosure.P: Intermediate document.T: Theory or principle underlying the invention.E: Earlier patent application, but published after the filing date of the application searched (potentially conflicting patent documents).D: Document cited in the application.L: Document cited for other reasons.R: Referring to a patent application or a utility model filed on the same day that relates to the same invention
Classification Value
I- InventionL- Later
Classification Symbol Position
F- FirstA- Additional
Priority Linkage Type
DEFAULT- Default valuePCT_REGIONAL_FILING- PCT application claimed as a regional filingDIVISION- Prior application claimed for a divisionCONTINUATION- Prior application claimed for continuationTECHNICAL_PRIORITY- Technical priorityPCT_PARIS_CONVENTION- PCT application claimed under the Paris ConventionCONTINUATION_IN_PART- Prior application claimed for continuation in partABANDONED_CONTINUATION- Claimed for continuation [abandoned]ABANDONED_CIP- Claimed for continuation in part [abandoned]DOMESTIC_PRIORITY_PATENT- Domestic priority claimed for patentABANDONED_DIVISION- Claimed for a division [abandoned]ADDITION- Prior application claimed for an additionDOMESTIC_PRIORITY_UTILITY- Domestic priority claimed for utility modelPATENT_FOR_UTILITY_MODEL- Patent application claimed for utility modelORIGINAL_REISSUE- Claimed application is an original reissue serial numberPATENT_TO_UTILITY- Cited application changed from patent to utilityDOMESTIC_PRIORITY- Domestic priorityUNKNOWN- Unknown linkage typeUTILITY_TO_PATENT- Cited application changed from utility to patentCOGNATE- Cognate applicationEP_REGIONAL_FILING- EP application claimed as a regional filingDIVISION_OF_DIVISION- Prior application claimed for a division of a divisionDIVISION_2- Prior application claimed for 2 divisionSUPPLEMENTARY_DISCLOSURE- Claimed application is a supplementary disclosureWIDERRECHTLICHE_ENTNAHME- Widerrechtliche Entnahme claimed ApplicationRE_EXAMINATION- Request for re-examination numberSUBSTITUTE- Prior application claimed for a substitute
Sample Patent Record
Request:
{
"query":{
"match":{"lens_id":"031-156-664-516-153"}
}
}
Response:
{
"total": 1,
"max_score": 16.891047,
"data": [
{
"lens_id": "031-156-664-516-153",
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "A1",
"date_published": "2012-07-04",
"doc_key": "EP_2471949_A1_20120704",
"docdb_id": 364714255,
"lang": "en",
"biblio": {
"publication_reference": {
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "A1",
"date": "2012-07-04"
},
"application_reference": {
"jurisdiction": "EP",
"doc_number": "10197481",
"kind": "A",
"date": "2010-12-31"
},
"application_number": "10197481.4",
"priority_claims": {
"claims": [
{
"jurisdiction": "EP",
"doc_number": "10197481",
"kind": "A",
"date": "2010-12-31",
"sequence": 1
}
],
"earliest_claim": {
"date": "2010-12-31"
}
},
"invention_title": [
{
"text": "Verfahren zur Identifizierung durch Molekulartechniken von genetischen Varianten, die kein D-Antigen (D-) und das veränderte C-Antigen (C+W) codieren",
"lang": "de"
},
{
"text": "Method for the identification by molecular techniques of genetic variants that encode no D antigen (D-) and altered C antigen (C+W)",
"lang": "en"
},
{
"text": "Procédé pour l'identification par des techniques moléculaires de variantes génétiques ne codant pas d'antigène D (D-) et qui codent l'antigène C modifié (C+W)",
"lang": "fr"
}
],
"parties": {
"applicants": [
{
"residence": "ES",
"extracted_name": {
"value": "PROGENIKA BIOPHARMA SA"
}
}
],
"inventors": [
{
"residence": "ES",
"sequence": 1,
"extracted_name": {
"value": "OCHOA JORGE"
}
},
{
"residence": "ES",
"sequence": 2,
"extracted_name": {
"value": "LOPEZ MONICA"
}
},
{
"residence": "ES",
"sequence": 3,
"extracted_name": {
"value": "TEJEDOR DIEGO"
}
},
{
"residence": "ES",
"sequence": 4,
"extracted_name": {
"value": "MARTINEZ ANTONIO"
}
},
{
"residence": "ES",
"sequence": 5,
"extracted_name": {
"value": "SIMON LAUREANO"
}
}
],
"agents": [
{
"extracted_name": {
"value": "Casley, Christopher Stuart"
},
"extracted_address": "Mewburn Ellis LLP \n33 Gutter Lane, London\nEC2V 8AS",
"extracted_country": "GB"
}
],
"owners_all": [
{
"recorded_date": "2013-12-11",
"execution_date": "2013-12-11",
"extracted_name": {
"value": "PROGENIKA BIOPHARMA, S.A."
}
}
]
},
"classifications_ipcr": {
"classifications": [
{
"symbol": "C12Q1/68",
"classification_value": "I",
"classification_symbol_position": "F"
}
]
},
"classifications_cpc": {
"classifications": [
{
"symbol": "C12Q1/6881",
"classification_value": "I",
"classification_symbol_position": "F"
},
{
"symbol": "C12Q2600/156",
"classification_value": "A",
"classification_symbol_position": "L"
},
{
"symbol": "C12Q1/6881",
"classification_value": "I",
"classification_symbol_position": "F"
},
{
"symbol": "A61K35/14",
"classification_value": "I",
"classification_symbol_position": "L"
},
{
"symbol": "C12Q2600/156",
"classification_value": "A",
"classification_symbol_position": "L"
}
]
},
"references_cited": {
"citations": [
{
"sequence": 1,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2006075254",
"kind": "A2",
"date": "2006-07-20"
},
"lens_id": "185-701-234-511-622"
},
"category": [
"X"
],
"cited_phase": "SEA"
},
{
"sequence": 2,
"nplcit": {
"text": "AVENT N D ET AL: \"The bloodgen project of the European Union, 2003-2009\", TRANSFUSION MEDICINE AND HEMOTHERAPY 2009 S. KARGER AG CHE LNKD- DOI:10.1159/000218192, vol. 36, no. 3, June 2009 (2009-06-01), pages 162 - 167, XP002633276, ISSN: 1660-3796",
"lens_id": "004-047-148-411-345",
"external_ids": [
"pmc2980524",
"21113258",
"10.1159/000218192"
]
},
"category": [
"I"
],
"cited_phase": "SEA"
},
{
"sequence": 3,
"nplcit": {
"text": "WESTHOFF CONNIE M ET AL: \"DIIIa and DIII Type 5 are encoded by the same allele and are associated with altered RHCE*ce alleles: clinical implications\", TRANSFUSION (MALDEN), vol. 50, no. 6, June 2010 (2010-06-01), pages 1303 - 1311, XP002633277, ISSN: 0041-1132",
"lens_id": "125-529-168-227-632",
"external_ids": [
"20088832",
"pmc2908519",
"10.1111/j.1537-2995.2009.02573.x"
]
},
"category": [
"X",
"D",
"I"
],
"cited_phase": "SEA"
},
{
"sequence": 4,
"nplcit": {
"text": "PHAM BACH-NGA ET AL: \"Heterogeneous molecular background of the weak C, VS+, hr(B)-, Hr(B)- phenotype in black persons\", TRANSFUSION (MALDEN), vol. 49, no. 3, March 2009 (2009-03-01), pages 495 - 504, XP002633278, ISSN: 0041-1132",
"lens_id": "086-240-354-498-516",
"external_ids": [
"10.1111/j.1537-2995.2008.02005.x",
"19040491"
]
},
"category": [
"X",
"D",
"I"
],
"cited_phase": "SEA"
},
{
"sequence": 5,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2006032897",
"kind": "A2",
"date": "2006-03-30"
},
"lens_id": "071-147-450-571-460"
},
"category": [
"Y"
],
"cited_phase": "SEA"
},
{
"sequence": 6,
"patcit": {
"document_id": {
"jurisdiction": "DE",
"doc_number": "10049363",
"kind": "A1",
"date": "2001-10-31"
},
"lens_id": "033-566-032-105-609"
},
"category": [
"Y"
],
"cited_phase": "SEA"
},
{
"sequence": 7,
"nplcit": {
"text": "FAAS B H W ET AL: \"Rh E/e genotyping by allele-specific primer amplification\", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 85, no. 3, 1 January 1995 (1995-01-01), pages 829 - 832, XP002614101, ISSN: 0006-4971",
"lens_id": "017-174-583-162-658",
"external_ids": [
"7833484",
"10.1182/blood.v85.3.829.bloodjournal853829"
]
},
"category": [
"Y"
],
"cited_phase": "SEA"
},
{
"sequence": 8,
"nplcit": {
"text": "MAASKANT-VAN WIJK P A ET AL: \"GENOTYPING OR RHD BY MULTIPLEX POLYMERASE CHAIN REACTIONS ANALYSIS OF SIX RHD-SPECIFIC EXONS\", TRANSFUSION, AMERICAN ASSOCIATION OF BLOOD BANKS, BETHESDA, MD, US, vol. 11, no. 38, 1 November 1998 (1998-11-01), pages 1015 - 1021, XP008005129, ISSN: 0041-1132, DOI: 10.1046/J.1537-2995.1998.38111299056309.X",
"lens_id": "059-652-196-800-856",
"external_ids": [
"10.1046/j.1537-2995.1998.38111299056309.x",
"9838930"
]
},
"category": [
"Y"
],
"cited_phase": "SEA"
},
{
"sequence": 9,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2011003921",
"kind": "A2",
"date": "2011-01-13"
},
"lens_id": "187-498-666-224-100"
},
"category": [
"E"
],
"cited_phase": "SEA"
},
{
"sequence": 1,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2009000084",
"kind": "A1",
"date": "2008-12-31"
},
"lens_id": "096-184-763-479-702"
},
"cited_phase": "APP"
},
{
"sequence": 2,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010000210",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "082-610-612-867-442"
},
"cited_phase": "APP"
},
{
"sequence": 3,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010000380",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "080-193-167-878-372"
},
"cited_phase": "APP"
},
{
"sequence": 4,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010000635",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "160-241-370-254-307"
},
"cited_phase": "APP"
},
{
"sequence": 5,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010000972",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "189-848-800-128-321"
},
"cited_phase": "APP"
},
{
"sequence": 6,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010002366",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "091-724-438-661-108"
},
"cited_phase": "APP"
},
{
"sequence": 7,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010002367",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "180-004-304-457-874"
},
"cited_phase": "APP"
},
{
"sequence": 8,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010003113",
"kind": "A1",
"date": "2010-01-07"
},
"lens_id": "014-308-334-256-321"
},
"cited_phase": "APP"
},
{
"sequence": 9,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010003649",
"kind": "A1",
"date": "2010-01-14"
},
"lens_id": "149-519-969-815-807"
},
"cited_phase": "APP"
},
{
"sequence": 10,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010003664",
"kind": "A1",
"date": "2010-01-14"
},
"lens_id": "134-590-889-498-511"
},
"cited_phase": "APP"
},
{
"sequence": 11,
"patcit": {
"document_id": {
"jurisdiction": "WO",
"doc_number": "2010003809",
"kind": "A2",
"date": "2010-01-14"
},
"lens_id": "087-699-367-879-444"
},
"cited_phase": "APP"
},
{
"sequence": 12,
"nplcit": {
"text": "M. E. REID; C. LOMAS-FRANCIS: \"The Blood Group Antigen FactsBook\", 2004, ELSEVIER LTD."
},
"cited_phase": "APP"
},
{
"sequence": 13,
"nplcit": {
"text": "CONNIE M.; WESTHOFF, SUNITHA VEGE; CHRISTINE HALTER-HIPSKY; TRINA WHORLEY; KIM HUE-ROYE; CHRISTINE LOMAS-FRANCIS; MARION E.: \"Dllla and Dill Type 5 are encoded by the same allele and are associated with altered RHCE*ce alleles: clinical implications\", REID. TRANSFUSION, vol. 50, 2010, pages 1303 - 1311",
"lens_id": "125-529-168-227-632",
"external_ids": [
"20088832",
"pmc2908519",
"10.1111/j.1537-2995.2009.02573.x"
]
},
"cited_phase": "APP"
},
{
"sequence": 14,
"nplcit": {
"text": "BACH-NGA PHAM; THIERRY PEYRARD; GENEVIEVE JUSZCZAK; ISABELLE DUBEAUX; DOMINIQUE GIEN; ANTOINE BLANCHER; JEAN-PIERRE CARTRON; PHILI: \"Heterogeneous molecular background of the weak C, VS+, hrB-, HrB- phenotype in black persons\", TRANSFUSION, vol. 49, 2009, pages 495 - 504",
"lens_id": "086-240-354-498-516",
"external_ids": [
"10.1111/j.1537-2995.2008.02005.x",
"19040491"
]
},
"cited_phase": "APP"
},
{
"sequence": 15,
"nplcit": {
"text": "MARTINE G.H.M.; TAX, C.; ELLEN VAN DER SCHOOT; RENE' VAN DOORN; LOTTE DOUGLAS-BERGER; DICK J.; VAN RHENEN; PETRA A.; MAASKANT-VAN: \"RHC and RHc genotyping in different ethnic groups\", TRANSFUSION, vol. 42, 2002, pages 6234 - 644",
"lens_id": "028-957-496-647-171",
"external_ids": [
"12084173",
"10.1046/j.1537-2995.2002.00096.x"
]
},
"cited_phase": "APP"
},
{
"sequence": 16,
"nplcit": {
"text": "M. E. REID; C. LOMAS-FRANCIS.: \"The Blood group antigen FactsBook\", 2004, ELSEVIER LTD."
},
"cited_phase": "APP"
}
],
"patent_count": 15,
"npl_count": 10,
"npl_resolved_count": 8
},
"cited_by": {
"patents": [
{
"document_id": {
"jurisdiction": "WO",
"doc_number": "2014135331",
"kind": "A1"
},
"lens_id": "089-849-576-069-505"
},
{
"document_id": {
"jurisdiction": "WO",
"doc_number": "2012171990",
"kind": "A1"
},
"lens_id": "084-623-881-707-629"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "9359643",
"kind": "B2"
},
"lens_id": "007-584-344-944-889"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "10253366",
"kind": "B2"
},
"lens_id": "172-445-088-115-557"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "9637788",
"kind": "B2"
},
"lens_id": "138-800-291-931-331"
}
],
"patent_count": 5
}
},
"families": {
"simple_family": {
"family_id": 212482337,
"members": [
{
"document_id": {
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "B1",
"date": "2013-12-25"
},
"lens_id": "033-643-087-926-128"
},
{
"document_id": {
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "A1",
"date": "2012-07-04"
},
"lens_id": "031-156-664-516-153"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "20120172239",
"kind": "A1",
"date": "2012-07-05"
},
"lens_id": "095-621-040-202-546"
},
{
"document_id": {
"jurisdiction": "ES",
"doc_number": "2445709",
"kind": "T3",
"date": "2014-03-04"
},
"lens_id": "192-287-095-019-170"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "20160060696",
"kind": "A1",
"date": "2016-03-03"
},
"lens_id": "126-336-041-308-107"
}
],
"size": 5
},
"extended_family": {
"family_id": 212231137,
"members": [
{
"document_id": {
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "B1",
"date": "2013-12-25"
},
"lens_id": "033-643-087-926-128"
},
{
"document_id": {
"jurisdiction": "EP",
"doc_number": "2471949",
"kind": "A1",
"date": "2012-07-04"
},
"lens_id": "031-156-664-516-153"
},
{
"document_id": {
"jurisdiction": "ES",
"doc_number": "2445709",
"kind": "T3",
"date": "2014-03-04"
},
"lens_id": "192-287-095-019-170"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "20120172239",
"kind": "A1",
"date": "2012-07-05"
},
"lens_id": "095-621-040-202-546"
},
{
"document_id": {
"jurisdiction": "US",
"doc_number": "20160060696",
"kind": "A1",
"date": "2016-03-03"
},
"lens_id": "126-336-041-308-107"
}
],
"size": 5
}
},
"sequence_listing": {
"sequence_types": [
"N",
"DNA"
],
"length_buckets": [
"NT_1_100",
"NT_5001_100000",
"NT_101_5000"
],
"organisms": [
{
"tax_id": 9606,
"name": "Homo sapiens"
},
{
"tax_id": -1,
"name": "Unknown/Artificial"
}
],
"count": 42
},
"legal_status": {
"granted": true,
"grant_date": "2013-12-25",
"anticipated_term_date": "2030-12-31",
"calculation_log": [
"Application Filing Date: 2010-12-31",
"Granted Date: 2013-12-25",
"Anticipated Termination Date: 2030-12-31"
],
"patent_status": "ACTIVE"
},
"abstract": [
{
"text": "The invention relates to the field of genotyping and blood cell antigen determination. In particular, the invention adresses the problem of discriminating the RHD*DIIIa-CE(4-7)-D or RHD*DIIIa-CE(4-7)-D )-like blood type variants, which express the C +w antigen and lack a D antigen, from RHD*DIIIa , RHD*DIVa-2 and other blood type variants. The invention provides methods for genotyping a subject, comprising: a) determining at least 4 markers in a sample that has been obtained from the subject, wherein the markers comprise: (i) the presence or absence of an RHCE*C allele; (ii) the presence or absence of an RHD/RHCE hybrid exon 3 (RHD/CE Hex03) allele; (iii) the absence of, or a single nucleotide polymorphism (SNP) variant within, of any one of the SNPs at position 602 of RHD exon 4, position 667 of RHD exon 5, or position 819 of RHD exon 6; and (iv) the absence of, or SNP variant within, of the SNP at position 1048 of RHD exon 7. The invention also provides products, in particular, probes, primers and kits for use in such methods.",
"lang": "en"
}
],
"claims": [
{
"claims": [
{
"claim_text": [
"A method of genotyping a subject, the method comprising:\n determining at least 4 markers in a sample that has been obtained from the subject, wherein the markers comprise:\n (i) the presence or absence of an RHCE*C allele; \n (ii) the presence or absence of an RHD/RHCE hybrid exon 3 (RHD/CE Hex03) allele; \n (iii) the absence of, or a single nucleotide polymorphism (SNP) variant within, any one of RHD exon 4, RHD exon 5, or RHD exon 6; and \n (iv) the absence of, or SNP variant within, RHD exon 7."
]
},
{
"claim_text": [
"A method according to claim 1, wherein:\n a) the SNP variant within RHD exon 4 is at position 602 of the RHD coding sequence (rs1053355), the SNP variant within RHD exon 5 is at position 667 of the RHD coding sequence (rs1053356), the SNP variant within RHD exon 6 is at position 819 of the RHD coding sequence; and/or \n b) the SNP variant within RHD exon 7 is at position 1048 of the RHD coding sequence (rs41307826)."
]
},
{
"claim_text": [
"A method according to claim 1 or 2, wherein the markers further comprise:\n (v) the presence or absence of an RHD exon 3 allele."
]
},
{
"claim_text": [
"A method according to any one of the preceding claims, wherein:\n a) the method further comprises determining the RHD and RHC antigen phenotypes of the subject; and/or \n b) the method comprises detecting the presence or absence of a blood type variant selected from: RHD*DIIIa ; RHD*DIVa-2; or RHD*DIIIa-CE(4-7)-D or RHD*DIIIa-CE(4-7)-D )-like blood type variants, e.g. wherein the method comprises detecting the presence or absence of RHD*DIIIa-CE(4-7)-D or RHD*DIIIa-CE(4-7)-D )-like blood type variants; and/or \n c) marker (iii) is the SNP within RHD exon 4 at position 602 of the RHD coding sequence (rs1053355); and/or \n d) the RHCE*C allele is determined by determining the presence or absence of RHCE*C intron 2, or any one of the following positions in the RHCE coding sequence: position 307 (exon 2), position 48 (exon 1), position 150 (exon 2), position 178 (exon 2), position 201 (exon 2) and/or position 203 (exon 2)."
]
},
{
"claim_text": [
"A method according to any one of the preceding claims, wherein the sample comprises nucleic acid and the method comprises amplifying the nucleic acid or a portion thereof by PCR using primers, e.g. wherein:\n a) the PCR primers for determining the RHCE*C allele are a forward PCR primer specific for RHCE*C, and a non-specific reverse PCR primer, e.g. wherein\n (i) the non-specific reverse primer is shared with RHD, RHC*C and/or RHC*c; and/or \n (ii) the PCR primers comprise:\n Forward: 5'-GGCCACCACCATTTGAA-3' (SEQ ID NO: 3) \n Reverse: 5'-CCATGAACATGCCACTTCAC-3', (SEQ ID NO: 4) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n b) the PCR primers for determining the RHD/CE Hex03 allele are forward and reverse PCR primers targeting sequences located in introns 2 and 3, or introns 3 and 2, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TCCTGGCTCTCCCTCTCT-3' (SEQ ID NO: 9) \n Reverse primer: 5'-TTTTCAAAACCCCGGAAG-3 (SEQ ID NO: 10) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n c) the PCR primers for determining the SNP within RHD exon 4 at position 602 of the RHD coding sequence (rs1053355) are forward and reverse primers targeting sequences located in introns 3 and 4, or introns 4 and 3, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-GCTCTGAACTTTCTCCAAGGACT-3' (SEQ ID NO: 17) \n Reverse primer: 5'-ATTCTGCTCAGCCCAAGTAG-3' (SEQ ID NO: 18) or a variant thereof having up to 4 nucleotide alterations; and/or \n d) the PCR primers for determining the SNP within RHD exon 5 at position 667 of the RHD coding sequence (rs1053356) are forward and reverse primers targeting sequences located in introns 4 and 5, or introns 5 and 4, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TTGAATTAAGCACTTCACAGAGCA-3' (SEQ ID NO: 19) \n Reverse primer: 5'-CACCTTGCTGATCTTCCC-3' (SEQ ID NO: 20) or a variant thereof having up to 4 nucleotide alterations; and/or \n e) the PCR primers for determining the SNP within RHD exon 6 at position 819 of the RHD coding sequence are forward and reverse primers targeting sequences located in introns 5 and 6, or introns 6 and 5, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-AGTAGTGAGCTGGCCCATCA-3' (SEQ ID NO: 21) \n Reverse primer: 5'-CTTCAGCCAAAGCAGAGGAG-3' (SEQ ID NO: 22) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n f) the PCR primers for determining the SNP within RHD exon 7 at position 1048 of the RHD coding sequence (rs41307826) are forward and reverse primers targeting sequences located in introns 6 and 7, or introns 7 and 6, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-ACAAACTCCCCGATGATGTGAGTG-3' (SEQ ID NO: 35) \n Reverse primer: 5'-GAGGCTGAGAAAGGTTAAGCCA-3' (SEQ ID NO: 36) \nor a variant thereof having up to 4 nucleotide alterations; and/or \n g) as dependent from claim 3, the PCR primers for determining the RHD exon 3 allele are forward and reverse primers targeting sequences located in introns 2 and 3, or introns 3 and 2, respectively, e.g. wherein\n (i) the PCR primers comprise:\n Forward primer: 5'-TCCTGGCTCTCCCTCTCT-3' (SEQ ID NO: 15) \n Reverse primer: 5'-GTTGTCTTTATTTTTCAAAACCCT-3' (SEQ ID NO: 16) \nor a variant thereof having up to 4 nucleotide alterations."
]
},
{
"claim_text": [
"A method according to claim 5, wherein the amplified nucleic acid comprises a label, e.g. wherein\n a) the label comprises a biotinylated nucleotide; and/or \n b) the label comprises a fluorescent moiety."
]
},
{
"claim_text": [
"A method according to any one of the preceding claims, wherein the sample comprises nucleic acid, and the method comprises amplifying the nucleic acid or a portion thereof by PCR using primers, fragmenting the amplified nucleic acid, and labelling the fragmented nucleic acid with biotinylated ddNTPS using a terminal deoxynucleotidyl transferase (TdT) enzyme."
]
},
{
"claim_text": [
"A method according to any one of the preceding claims, wherein determining the presence, absence or SNP variant of a marker comprises contacting nucleic acid containing each marker with one or more probes, e.g. wherein:\n a) as dependent from claim 3, the probes for determining the presence or absence of RHD/CE Hex03 or RHD exon 3 contact an SNP located in both RHD/CE Hex03 and RHD exon 3, wherein one SNP variant is specific for RHD/CE Hex03, and another SNP variant is specific for RHD exon 3, e.g. wherein\n (i) the SNP is at position 410 of the coding sequence, located within both RHD/CE Hex03 and RHD exon 3; and/or \n (ii) the probes comprise:\n (1) 5'-TTTTACAGACGCCTGCTACCATG-3', (SEQ ID NO: 5) \n (2) 5'-CATGGTAGCAGGCGTCTGTAAAA-3', (SEQ ID NO: 6) \n (3) 5'-TTTTACAGACGTCTGCTACCATG-3', (SEQ ID NO: 7) and \n (4) 5'-CATGGTAGCAGACGTCTGTAAAA-3', (SEQ ID NO: 8) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; and/or \n b) the probes for determining the absence or SNP variant of the SNP at: position 602 of the RHD coding sequence located within exon 4 (rs1053355), position 667 of the RHD coding sequence located within exon 5 (rs1053356), or position 819 of the RHD coding sequence located within exon 6 comprise:\n (i) RHD exon 4:\n (1) 5'-ATAAAGATCAGACAGCAACGATACC-3' (SEQ ID NO: 23) \n (2) 5'-TAAAGATCAGACAGCAACGATAC-3' (SEQ ID NO: 24) \n (3) 5'-ATAAAGATCAGAGAGCAACGATACC-3' (SEQ ID NO: 25) \n (4) 5'-TAAAGATCAGAGAGCAACGATAC-3' (SEQ ID NO: 26) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; \n (ii) RHD exon 5:\n (1) 5'-CTGGCCAAGTTTCAACTCTGC-3' (SEQ ID NO: 27) \n (2) 5'-TGGCCAAGTTTCAACTCTG-3' (SEQ ID NO: 28) \n (3) 5'-CTGGCCAAGTGTCAACTCTGC-3' (SEQ ID NO: 29) \n (4) 5'-TGGCCAAGTGTCAACTCTG-3' (SEQ ID NO: 30) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations; \n (iii) RHD exon 6:\n (1) 5'-GTGCACAGTGCGGTGTTGGCAGG-3' (SEQ ID NO: 31) \n (2) 5'- TGCACAGTGCGGTGTTGGCAG -3' (SEQ ID NO: 32) \n (3) 5'- GTGCACAGTGCAGTGTTGGCAGG -3' (SEQ ID NO: 33) \n (4) 5'-TGCACAGTGCAGTGTTGGCAG-3' (SEQ ID NO: 34) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations. \n c) the probes for determining the SNP variant of the SNP at position 1048 of the RHD coding sequence located within exon 7 (rs41307826)comprise:\n (1) 5'-TGCTGGTGCTTGATACCGTCGGA-3' (SEQ ID NO: 37) \n (2) 5'-GCTGGTGCTTGATACCGTCGG-3' (SEQ ID NO: 38) \n (3) 5'-TGCTGGTGCTTCATACCGTCGGA-3' (SEQ ID NO: 39) \n (4) 5'-GCTGGTGCTTCATACCGTCGG-3' (SEQ ID NO: 40) \nor a variant of any one of probes 1 to 4 having up to 4 nucleotide alterations."
]
},
{
"claim_text": [
"A method according to claim 8, wherein\n a) one or more of the probes comprise a label, e.g. wherein the label is a fluorescent moiety; and/or \n b) one or more of the probes is attached to a solid support or conjugated to one or more particles.."
]
},
{
"claim_text": [
"A set of primers for amplifying nucleic acid comprising at least four of the markers described in claim 1, 2, 3, 4(c), and 4(d), e.g. wherein the set of primers comprises at least three primer pairs selected from the primers set forth in:\n (i) claim 5(a), \n (ii) claim 5(b), \n (iii) any one of claims 5(c), 5(d) or 5(e) \n (iv) claim 5(f), and \n (v) claim 5(g)."
]
},
{
"claim_text": [
"A set of primers for amplifying nucleic acid comprising at least three primer pairs selected from the primers set forth in:\n (i) claim 3(a)(ii), \n (ii) claim 3(b)(i), \n (iii) any one of claims 3(c)(i), 3(d)(i) or 3(e)(i), \n (iv) claim 3(f)(i), and \n (v) claim 3(g)(i)."
]
},
{
"claim_text": [
"A set of primers for amplifying nucleic acid , wherein at least 50% are the primer pairs described in claim 10 or 11."
]
},
{
"claim_text": [
"A set of probes for determining the presence, absence or single nucleotide polymorphism (SNP) variant of at least three of the markers described in claim 1, 2, 3, 2(c) and 2(d), e.g. wherein:\n a) the set of probes comprises the probes described in claims 8(a), 8(b) and 8(c)."
]
},
{
"claim_text": [
"A set of probes according to claim 13, wherein:\n a) the probes are immobilised on a solid support or conjugated to one or more particles, e.g. wherein the solid support comprises one or more attached labels, e.g. wherein the label is a fluorochrome; and/or \n b) one or more probes comprise a label, e.g wherein the label is a fluorescent moiety."
]
},
{
"claim_text": [
"A kit for genotyping a subject, the kit comprising a set of PCR primers according to any one of claims 10 to 12, and a set of probes according to any one of claims 13 or 14."
]
}
],
"lang": "en"
}
],
"description": {
"text": "Field of the Invention The invention relates to methods for genotyping and blood cell antigen determination, which in particular may discriminate the RHD*DIIIa-CE(4-7)-D or RHD*DIIIa-CE(4-7)-D )-like blood type variants, which express the C +W antigen and lack a D antigen, from RHD*DIIIa , RHD*DIVa-2 and other blood type variants...",
"lang": "en"
},
"publication_type": "PATENT_APPLICATION"
}
],
"results": 1
}